Restriction enzyme HpyCH4 V cuts DNA fragments at the sequence TGCA between the G and C, as shown in the image.

How many "cuts" will be made using this enzyme on the following DNA sequence: TGCAAAAGGTGCATTCGTGCA
What is used to cut long strands of DNA into smaller fragments?
Which of the following is true about gel electrophoresis?
Using the steps above, what is the correct order of the steps for creating a DNA fingerprint?