Log inSign up for FREE
Library

DNA Analysis Practice

Last updated over 3 years ago
4 questions
Restriction enzyme HpyCH4 V cuts DNA fragments at the sequence TGCA between the G and C, as shown in the image.
1

How many "cuts" will be made using this enzyme on the following DNA sequence: TGCAAAAGGTGCATTCGTGCA

1

What is used to cut long strands of DNA into smaller fragments?

1

Which of the following is true about gel electrophoresis?

The steps of gel electrophoresis are below. They are not in the correct order.

  1. Load the DNA into the wells of the gel. Include a DNA control for comparison.
  2. Watch as the smaller DNA fragments move toward the positive end of the gel.
  3. Cut DNA into fragments with restriction enzymes
  4. Connect the gel chamber to an electrical current.
  5. Stain the DNA bands to make them easily visible.
1

Using the steps above, what is the correct order of the steps for creating a DNA fingerprint?