Effects of Mutations Formative

Required

1

Compare the mutated DNA sequence to the original. Identify the mutation as either an insertion, deletion, or substitution, and whether it is a frameshift, missense, nonsense, or silent mutation.

Original DNA Sequence: T A C A C C T T G G C G A C G A C T

Mutated DNA Sequence: T A C A T C T T G G C G A C G A C T

LS1.D

Required

1

Match the following terms with their definitions

Draggable item		Corresponding Item

LS1.D

Required

1

True or false: ALL mutations effect the resulting protein

LS1.D

Required

1

Which type of mutation listed below is most likely going to cause a frameshift mutation?

LS1.D

Required

1

What is a mutagen?

LS1.D

Required

1

How do mutations happen spontaneously without any outside influence?

LS1.D

To use the codon table, follow these directions:

find the first base in the codon along the left hand side of the table
find the second base in the codon along the top of the table and follow it down until you find the box that corresponds to the base on the left hand side you identified in step 1
find the third base in the codon along the right hand side of the box and follow that line over to the box you identified in step 2.  The three-letter abbreviation next to your identified codon is the amino acid that codon translates into.

Required

1

Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:
TACACGCAATTACCAGGGTAGCCATTGATT
Use the space bar to separate your sequence into codons.

Required

0.5

Draggable item		Corresponding Item
Point Mutation		sequence of DNA that codes for a particular protein
Mutagen		any change in the sequence of DNA that may or may not affect the protein made by that sequence
mutation		Mutation affecting a single gene or base pair within a gene
Chromosome Mutation		mutations that cause major changes to proteins because they "shift" the reading frame of the genetic code
Frameshift Mutation		Mutations that affect entire regions of chromosomes, or multiple chromosomes
gene		Any environmental factor that may cause a mutation

Effects of Mutations Formative

Match the following terms with their definitions

True or false: ALL mutations effect the resulting protein

Which type of mutation listed below is most likely going to cause a frameshift mutation?

What is a mutagen?

How do mutations happen spontaneously without any outside influence?

Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:
TACACGCAATTACCAGGGTAGCCATTGATT
Use the space bar to separate your sequence into codons.

What would happen if there was a substitution mutation that changed the 5th base in the DNA from a C to a T?

Match the following terms with their definitions

True or false: ALL mutations effect the resulting protein

Which type of mutation listed below is most likely going to cause a frameshift mutation?

What is a mutagen?

How do mutations happen spontaneously without any outside influence?

Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:
TACACGCAATTACCAGGGTAGCCATTGATT
Use the space bar to separate your sequence into codons.

What would happen if there was a substitution mutation that changed the 5th base in the DNA from a C to a T?

Effects of Mutations Formative

Effects of Mutations Formative

Match the following terms with their definitions

True or false: ALL mutations effect the resulting protein

Which type of mutation listed below is most likely going to cause a frameshift mutation?

What is a mutagen?

How do mutations happen spontaneously without any outside influence?

Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:TACACGCAATTACCAGGGTAGCCATTGATT Use the space bar to separate your sequence into codons.

What would happen if there was a substitution mutation that changed the 5th base in the DNA from a C to a T?

Match the following terms with their definitions

True or false: ALL mutations effect the resulting protein

Which type of mutation listed below is most likely going to cause a frameshift mutation?

What is a mutagen?

How do mutations happen spontaneously without any outside influence?

Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:TACACGCAATTACCAGGGTAGCCATTGATT Use the space bar to separate your sequence into codons.

What would happen if there was a substitution mutation that changed the 5th base in the DNA from a C to a T?

Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:
TACACGCAATTACCAGGGTAGCCATTGATT
Use the space bar to separate your sequence into codons.

Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:
TACACGCAATTACCAGGGTAGCCATTGATT
Use the space bar to separate your sequence into codons.