Compare the mutated DNA sequence to the original. Identify the mutation as either an insertion, deletion, or substitution, and whether it is a frameshift, missense, nonsense, or silent mutation.
Original DNA Sequence: T A C A C C T T G G C G A C G A C T
Mutated DNA Sequence: T A C A T C T T G G C G A C G A C T
Match the following terms with their definitions
| Draggable item | arrow_right_alt | Corresponding Item |
|---|---|---|
Mutagen | arrow_right_alt | sequence of DNA that codes for a particular protein |
Chromosome Mutation | arrow_right_alt | any change in the sequence of DNA that may or may not affect the protein made by that sequence |
Frameshift Mutation | arrow_right_alt | Mutation affecting a single gene or base pair within a gene |
mutation | arrow_right_alt | mutations that cause major changes to proteins because they "shift" the reading frame of the genetic code |
gene | arrow_right_alt | Mutations that affect entire regions of chromosomes, or multiple chromosomes |
Point Mutation | arrow_right_alt | Any environmental factor that may cause a mutation |
True or false: ALL mutations effect the resulting protein
Which type of mutation listed below is most likely going to cause a frameshift mutation?
What is a mutagen?
How do mutations happen spontaneously without any outside influence?
To use the codon table, follow these directions:
1. find the first base in the codon along the left hand side of the table
2. find the second base in the codon along the top of the table and follow it down until you find the box that corresponds to the base on the left hand side you identified in step 1
3. find the third base in the codon along the right hand side of the box and follow that line over to the box you identified in step 2. The three-letter abbreviation next to your identified codon is the amino acid that codon translates into.
Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:
TACACGCAATTACCAGGGTAGCCATTGATT
Use the space bar to separate your sequence into codons.
What would happen if there was a substitution mutation that changed the 5th base in the DNA from a C to a T?