DNA Analysis Practice

Last updated almost 4 years ago

4 questions

1

Restriction enzyme HpyCH4 V cuts DNA fragments at the sequence TGCA between the G and C, as shown in the image. 

1

What is used to cut long strands of DNA into smaller fragments?

Restriction Enzymes

Introns

RFLPs

Chromosomes

Which of the following is true about gel electrophoresis?

Smaller DNA fragments move faster and farther than larger DNA fragments

Larger DNA fragments move faster and farther than smaller DNA fragments

All DNA fragments move at the same rate despite their size

The steps of gel electrophoresis are below. They are not in the correct order. 

Load the DNA into the wells of the gel. Include a DNA control for comparison.
Watch as the smaller DNA fragments move toward the positive end of the gel.
Cut DNA into fragments with restriction enzymes
Connect the gel chamber to an electrical current.
Stain the DNA bands to make them easily visible.

Using the steps above, what is the correct order of the steps for creating a DNA fingerprint?

1, 2, 4, 5, 3

3, 1, 4, 2, 5

5, 3, 4, 2, 1

4, 5, 2, 3, 1

How many "cuts" will be made using this enzyme on the following DNA sequence: TGCAAAAGGTGCATTCGTGCA

1

2

3

4

What is used to cut long strands of DNA into smaller fragments?

Restriction Enzymes

Introns

RFLPs

Chromosomes

Which of the following is true about gel electrophoresis?

Smaller DNA fragments move faster and farther than larger DNA fragments

Larger DNA fragments move faster and farther than smaller DNA fragments

All DNA fragments move at the same rate despite their size

Using the steps above, what is the correct order of the steps for creating a DNA fingerprint?

1, 2, 4, 5, 3

3, 1, 4, 2, 5

5, 3, 4, 2, 1

4, 5, 2, 3, 1

How many "cuts" will be made using this enzyme on the following DNA sequence: TGCAAAAGGTGCATTCGTGCA

1

2

3

4