BioHon22_Quiz-Blank_Hornback

Last updated almost 4 years ago

12 questions

Required

BioHon22_Quiz-Blank_Hornback

Last updated almost 4 years ago

12 questions

Required

What does Meiosis create?

Required

If a black horse (Bb) created offspring with a brown horse (bb), what percentage of the offspring would be brown?

Required

A genotype is the type of _______ someone has while a phenotype is the _______ someone has. 

Required

Match each term to the corresponding category

Gametes
Somatic Cells

Haploid
Diploid

Required

What is the difference between the Pharynx and the Larynx of the Respiratory System?

Required

Draggable item		Corresponding Item

Required

Categorize each of the following terms as either apart of Systemic Circulation or Pulmonary Circulation

Right Ventricle
Pulmonary Vein
Capillaries in the Lungs

Required

Explain what Mitosis is and what happens to a cell during Mitosis.

DNA: ACGTACTGAAACGTTGCTAAACCGACTGGC

Required

Using the DNA Sequence given, Transcribe it into RNA

Required

Draggable item		Corresponding Item
Right Ventricle		Pulmonary Artery
Pulmonary Vein		Tricuspid Valve
Vena Cava		Aorta
Left Atrium		Mitral Valve
Right Atrium		Capillaries in the Body
Left Ventricle		Right Atrium
Aorta		Capillaries in the Lungs
Pulmonary Artery		Left Atrium

BioHon22_Quiz-Blank_Hornback

BioHon22_Quiz-Blank_Hornback

What does Meiosis create?

If a black horse (Bb) created offspring with a brown horse (bb), what percentage of the offspring would be brown?

Match each term to the corresponding category

What is the difference between the Pharynx and the Larynx of the Respiratory System?

Categorize each of the following terms as either apart of Systemic Circulation or Pulmonary Circulation

Explain what Mitosis is and what happens to a cell during Mitosis.

Using the DNA Sequence given, Transcribe it into RNA

Using the RNA Sequence entered in Question 10, Translate it into Amino Acids using a codon chart

If a mutation occurs in the Central Dogma, how would it affect the process? How would it affect the cell?

What does Meiosis create?

If a black horse (Bb) created offspring with a brown horse (bb), what percentage of the offspring would be brown?

Match each term to the corresponding category

Label the Diagram Correctly (In order from 1-11)

What is the difference between the Pharynx and the Larynx of the Respiratory System?

Match the term to where the blood would flow through next in the body

Categorize each of the following terms as either apart of Systemic Circulation or Pulmonary Circulation

Explain what Mitosis is and what happens to a cell during Mitosis.

Using the DNA Sequence given, Transcribe it into RNA

Using the RNA Sequence entered in Question 10, Translate it into Amino Acids using a codon chart

If a mutation occurs in the Central Dogma, how would it affect the process? How would it affect the cell?