
What is a mutant?
What creates a mutation?
There is no right or wrong answer, just explain your thinking.
If you missed class and want to watch me use the interactive below, click here to watch the recording.
Enter this DNA nucleotide sequence (avoid extra spaces!): ATGCTCTGTTTTATCTACGTCTCACCAACAGCCCATCAGAACAAGGATGAGTGGCGAAGCGGA
Click Transcribe and watch the simulation.
Click Translate and watch the simulation.
Examine the resulting protein. Click the amino acids to learn their names.
Put the steps of the transcription and translation process in order.
The tRNA (green) brings specific amino acids to the ribosome as the mRNA is read.
The mRNA (red) is built from the DNA (yellow/orange).
The mRNA leaves the nucleus and goes to the ribosome.
Amino acids form a chain to build a protein.
The strands of the DNA (yellow/orange) separate.
Enter this DNA nucleotide sequence (avoid extra spaces!). Notice that the 9th base has been changed from T to A: ATGCTCTGATTTATCTACGTCTCACCAACAGCCCATCAGAACAAGGATGAGTGGCGAAGCGGA
Click Transcribe and watch the simulation.
Click Translate and watch the simulation.
Examine the resulting protein. Click the amino acids to learn their names.
Compare the original protein:
How is it different from the protein that was just produced?
Enter this DNA nucleotide sequence (avoid extra spaces!). Notice that the 9th base has been changed from T to C: ATGCTCTGCTTTATCTACGTCTCACCAACAGCCCATCAGAACAAGGATGAGTGGCGAAGCGGA
Click Transcribe and watch the simulation.
Click Translate and watch the simulation.
Examine the resulting protein. Click the amino acids to learn their names.
Compare the original protein:
How is it different from the protein that was just produced?
Does a DNA mutation always change the protein? Why or why not?
What is a stop codon and what does it "stop" from happening?
In addition to substitution mutation, what other ways could a DNA nucleotide sequence mutate?
What effect could mutations have on an organism?
Self Assessment
Objective #1: I can identify the changes in amino acid sequences .
Self Assessment
Objective #2: I can consider possible impacts that changes in amino acid sequences may have on an organism .