Genetics, DNA, RNA, Protein Synthesis Test Summer School 2023

Last updated almost 2 years ago

28 questions

Note from the author:

Instructions

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1

Required

1.5

Required

1

Required

1

Required

1

Required

1

Don't forget you can use your notes!

Don't forget you can use your notes!

The Punnett square shown below describes a cross between two pea plants. The letter T represents the dominant allele for tall plant height, and the letter t represents the recessive allele for short plant height.

What were the genotypes of the parents that produced the offspring in the Punnett square?

TT for one parent, Tt for the other parent

TtTt for both parents

TT for one parent, tt for the other parent

Tt for both parents

Study the Punnett square shown here. It describes the potential offspring of a cross between two parents.

What phenotypes will be shown by the offspring?

Three fourths of the offspring will show the dominant phenotype and one fourth will show the recessive phenotype.

All offspring will show the recessive phenotype for this trait.

Half of the offspring will show the dominant phenotype and half will show the recessive phenotype.

All offspring will show the dominant phenotype for this trait.

What did Gregor Mendel study in his pea plant experiments?

Respiration

Photosynthesis

Mitosis

Inheritance patterns

One dog is heterozygous for black fur (Bb), and its mate is homozygous for blonde fur (bb). The Punnett square describes a cross between the two dogs.

What is the expected outcome of the cross?

Half of the offspring are heterozygous black (Bb); half are blonde (bb)

One fourth of the offspring are heterozygous black (Bb); one fourth are blonde (bb)

All of the offspring are heterozygous black (Bb)

Three fourths of the offspring are heterozygous black (Bb); one fourth are blonde (bb)

Meiosis creates 4 identical daughter cells, leading to identical parents and offspring.

True

False

Alvin is studying a model of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of four nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U).

Alvin’s observation most strongly supports which of these conclusions?

The nucleic acid is a form of RNA, and is not DNA.

The nucleic acid is either RNA or DNA.

The nucleic acid is DNA, and is not RNA.

The nucleic acid is either mRNA or rRNA, but not tRNA.

The diagram shows a portion of the genetic code. The diagram is read from the center of the circle outwards. So, the codon AGU is translated as serine, which is an amino acid.

Which conclusion about the genetic code is most strongly supported by the evidence presented in the diagram?

Many amino acids, although not all of them, may be encoded by more than one codon.

Many codons, although not all of them, may be translated into two or more amino acids.

All amino acids may be encoded by more than one codon.

Every codon may be translated into two or more amino acids.

A sequence of mRNA contains the following bases, which are translated as three codons.
ACUACGACA
Which amino acids are produced by this sequence? Select all of the amino acids that apply.

arginine, serine, and isoleucine

threonine only

threonine and arginine only

threonine, arginine, and isoleucine

If 15% of an organism’s DNA is thymine, what is the percentage of guanine?

15%

35%

70%

50%

A scientist uses radioactive isotopes to label a double-stranded molecule of DNA. Then the DNA undergoes replication in a non-radioactive medium. Where are the two original radioactive strands of DNA?

Both strands are intact, with one strand in each new DNA molecule.

One strand is intact, and the other strand is broken apart and distributed among the new DNA molecules.

Both strands are intact, and both are part of the same molecule of DNA.

The sequence of nitrogenous bases on a portion of a strand of DNA is shown in the diagram. From left to right, what is the corresponding sequence of the complementary strand?

G G U G T A T

C C A C T G A

T  T A G A T C

G G T G A C T

The model of the double-helix model of the DNA molecule resembles a twisted ladder.

What makes up the rungs of the twisted ladder?

paired sugars

hydrogen and oxygen atoms

paired nitrogenous bases

paired phosphate groups

This figure shows a section of a double-stranded DNA molecule.

What aspects of the structure of DNA are explained by this model? Select three
answer choices.

The two strands of DNA each have phosphate-sugar backbones.

Paired nucleotides are held together by hydrogen bonds.

Paired nucleotides are held together by covalent bonds.

Adenine is paired with thymine and guanine is paired with cytosine.

The diagram shows a model of DNA replication.

Which of the following labels should NOT be added to the model?

RNA polymerase

Nitrogenous bases

DNA polymerase

Replication fork

Griffith investigated how certain types of bacteria produce pneumonia in mice. The diagram outlines his experiments. What did Griffith conclude from these experiments?

The R type bacteria produced a poison that caused disease in mice.

The heat-killed S type bacteria became harmless when injected into the mice
along with the R type bacteria.

The S type bacteria produced a poison that made mice sick.

The heat-killed S type bacteria transformed the harmless R type bacteria into
disease-causing cells.

The table shows data that Chargaff collected on nitrogenous bases in the DNA in five organisms.

Which statement did Chargaff conclude based on these data? (Note: A letter in brackets, such as [A] or [C], refers to the concentration of one of the nitrogenous bases.)

in DNA molecules, [A] = [T], and [C ] = [G]

in DNA molecules [A] = [G], and [C ] = [T]

in single-stranded DNA molecules, [A] = [T] = [C ] = [G]

in DNA molecules, [T] > [A] > [G] > [C]

What is the process of creating an RNA molecule from a DNA sequence?

Mutation

Replication

Transcription

Translation

Which molecule serves as the template for protein synthesis?

DNA

mRNA

rRNA

tRNA

What is a DNA nucleotide made up of?

Sugar, phosphate, and nitrogenous base

Sugar, amino acid, and lipid

Amino acid, phosphate, and lipid

Sugar, lipid, and nitrogenous base

Which molecule helps transfer amino acids to the ribosome during protein synthesis?

tRNA

rRNA

DNA

mRNA

What is the primary function of DNA helicase?

Checks DNA for errors before replication.

Cuts and reforms phosphodiester bonds.

Stabilizes DNA strands during replication.

Unwinds DNA double helix for replication/translation.

What is the enzyme responsible for adding new nucleotides and proofreading during DNA replication?

Helicase

Ligase

RNA polymerase

DNA polymerase

Which molecule is single-stranded and contains uracil?

Ribosome

RNA

DNA

Amino acid

What are the three main functions of DNA?

Express

Serve

Store

Copy

What is the DNA base-pair rule?

A always pairs with G, T always pairs with C.

A always pairs with C, G always pairs with T.

A always pairs with U, C always pairs with G.

A always pairs with T, C always pairs with G.

A point mutation changes a codon in an mRNA molecule. Will the mutation affect the protein that forms? Why?

No. The structure of DNA, and not RNA, determines the polypeptide.

Yes. Each amino acid is specified by only one codon.

Maybe. Some sets of codons are translated into the same amino acid.

There are three main types of RNA: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA).
Which type or types of RNA contain a copy of the instructions that a gene
carries?

mRNA, rRNA, and tRNA

rRNA only

mRNA and tRNA

mRNA only

Robert is studying a long list of letters. The letters represent the order of
nitrogenous bases in a molecule of mRNA. The first several bases in the list are
shown below.
AUGCCACAGGUUCAUCCGAA…
To identify the amino acid sequence encoded by the mRNA, which would be the
most useful first step for Robert to follow?

Count the number of letters in the list.

Separate the list into three-letter “words.”

Separate the list into two-, three- and four-letter “words.”

Calculate the frequencies of each letter.

The Punnett square shown below describes a cross between two pea plants. The letter T represents the dominant allele for tall plant height, and the letter t represents the recessive allele for short plant height.

What were the genotypes of the parents that produced the offspring in the Punnett square?

TT for one parent, Tt for the other parent

TtTt for both parents

TT for one parent, tt for the other parent

Tt for both parents

Study the Punnett square shown here. It describes the potential offspring of a cross between two parents.

What phenotypes will be shown by the offspring?

Three fourths of the offspring will show the dominant phenotype and one fourth will show the recessive phenotype.

All offspring will show the recessive phenotype for this trait.

Half of the offspring will show the dominant phenotype and half will show the recessive phenotype.

All offspring will show the dominant phenotype for this trait.

What did Gregor Mendel study in his pea plant experiments?

Respiration

Photosynthesis

Mitosis

Inheritance patterns

One dog is heterozygous for black fur (Bb), and its mate is homozygous for blonde fur (bb). The Punnett square describes a cross between the two dogs.

What is the expected outcome of the cross?

Half of the offspring are heterozygous black (Bb); half are blonde (bb)

One fourth of the offspring are heterozygous black (Bb); one fourth are blonde (bb)

All of the offspring are heterozygous black (Bb)

Three fourths of the offspring are heterozygous black (Bb); one fourth are blonde (bb)

Meiosis creates 4 identical daughter cells, leading to identical parents and offspring.

True

False

Alvin is studying a model of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of four nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U).

Alvin’s observation most strongly supports which of these conclusions?

The nucleic acid is a form of RNA, and is not DNA.

The nucleic acid is either RNA or DNA.

The nucleic acid is DNA, and is not RNA.

The nucleic acid is either mRNA or rRNA, but not tRNA.

The diagram shows a portion of the genetic code. The diagram is read from the center of the circle outwards. So, the codon AGU is translated as serine, which is an amino acid.

Which conclusion about the genetic code is most strongly supported by the evidence presented in the diagram?

Many amino acids, although not all of them, may be encoded by more than one codon.

Many codons, although not all of them, may be translated into two or more amino acids.

All amino acids may be encoded by more than one codon.

Every codon may be translated into two or more amino acids.

A sequence of mRNA contains the following bases, which are translated as three codons.
ACUACGACA
Which amino acids are produced by this sequence? Select all of the amino acids that apply.

arginine, serine, and isoleucine

threonine only

threonine and arginine only

threonine, arginine, and isoleucine

If 15% of an organism’s DNA is thymine, what is the percentage of guanine?

15%

35%

70%

50%

A scientist uses radioactive isotopes to label a double-stranded molecule of DNA. Then the DNA undergoes replication in a non-radioactive medium. Where are the two original radioactive strands of DNA?

Both strands are intact, with one strand in each new DNA molecule.

One strand is intact, and the other strand is broken apart and distributed among the new DNA molecules.

Both strands are intact, and both are part of the same molecule of DNA.

The sequence of nitrogenous bases on a portion of a strand of DNA is shown in the diagram. From left to right, what is the corresponding sequence of the complementary strand?

G G U G T A T

C C A C T G A

T  T A G A T C

G G T G A C T

The model of the double-helix model of the DNA molecule resembles a twisted ladder.

What makes up the rungs of the twisted ladder?

paired sugars

hydrogen and oxygen atoms

paired nitrogenous bases

paired phosphate groups

This figure shows a section of a double-stranded DNA molecule.


What aspects of the structure of DNA are explained by this model? Select three
answer choices.

The two strands of DNA each have phosphate-sugar backbones.

Paired nucleotides are held together by hydrogen bonds.

Paired nucleotides are held together by covalent bonds.

Adenine is paired with thymine and guanine is paired with cytosine.

The diagram shows a model of DNA replication.

Which of the following labels should NOT be added to the model?

RNA polymerase

Nitrogenous bases

DNA polymerase

Replication fork

Griffith investigated how certain types of bacteria produce pneumonia in mice. The diagram outlines his experiments. What did Griffith conclude from these experiments?

The R type bacteria produced a poison that caused disease in mice.

The heat-killed S type bacteria became harmless when injected into the mice
along with the R type bacteria.

The S type bacteria produced a poison that made mice sick.

The heat-killed S type bacteria transformed the harmless R type bacteria into
disease-causing cells.

The table shows data that Chargaff collected on nitrogenous bases in the DNA in five organisms.

Which statement did Chargaff conclude based on these data? (Note: A letter in brackets, such as [A] or [C], refers to the concentration of one of the nitrogenous bases.)

in DNA molecules, [A] = [T], and [C ] = [G]

in DNA molecules [A] = [G], and [C ] = [T]

in single-stranded DNA molecules, [A] = [T] = [C ] = [G]

in DNA molecules, [T] > [A] > [G] > [C]

What is the process of creating an RNA molecule from a DNA sequence?

Mutation

Replication

Transcription

Translation

Which molecule serves as the template for protein synthesis?

DNA

mRNA

rRNA

tRNA

What is a DNA nucleotide made up of?

Sugar, phosphate, and nitrogenous base

Sugar, amino acid, and lipid

Amino acid, phosphate, and lipid

Sugar, lipid, and nitrogenous base

Which molecule helps transfer amino acids to the ribosome during protein synthesis?

tRNA

rRNA

DNA

mRNA

What is the primary function of DNA helicase?

Checks DNA for errors before replication.

Cuts and reforms phosphodiester bonds.

Stabilizes DNA strands during replication.

Unwinds DNA double helix for replication/translation.

What is the enzyme responsible for adding new nucleotides and proofreading during DNA replication?

Helicase

Ligase

RNA polymerase

DNA polymerase

Which molecule is single-stranded and contains uracil?

Ribosome

RNA

DNA

Amino acid

What are the three main functions of DNA?

Express

Serve

Store

Copy

What is the DNA base-pair rule?

A always pairs with G, T always pairs with C.

A always pairs with C, G always pairs with T.

A always pairs with U, C always pairs with G.

A always pairs with T, C always pairs with G.

A point mutation changes a codon in an mRNA molecule. Will the mutation affect the protein that forms? Why?

No. The structure of DNA, and not RNA, determines the polypeptide.

Yes. Each amino acid is specified by only one codon.

Maybe. Some sets of codons are translated into the same amino acid.

There are three main types of RNA: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA).
Which type or types of RNA contain a copy of the instructions that a gene
carries?

mRNA, rRNA, and tRNA

rRNA only

mRNA and tRNA

mRNA only

Robert is studying a long list of letters. The letters represent the order of
nitrogenous bases in a molecule of mRNA. The first several bases in the list are
shown below.
AUGCCACAGGUUCAUCCGAA…
To identify the amino acid sequence encoded by the mRNA, which would be the
most useful first step for Robert to follow?

Count the number of letters in the list.

Separate the list into three-letter “words.”

Separate the list into two-, three- and four-letter “words.”

Calculate the frequencies of each letter.

Genetics, DNA, RNA, Protein Synthesis Test Summer School 2023

Genetics, DNA, RNA, Protein Synthesis Test Summer School 2023

Study the Punnett square shown here. It describes the potential offspring of a cross between two parents.What phenotypes will be shown by the offspring?

What did Gregor Mendel study in his pea plant experiments?

One dog is heterozygous for black fur (Bb), and its mate is homozygous for blonde fur (bb). The Punnett square describes a cross between the two dogs.What is the expected outcome of the cross?

Meiosis creates 4 identical daughter cells, leading to identical parents and offspring.

Alvin is studying a model of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of four nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U).Alvin’s observation most strongly supports which of these conclusions?

The diagram shows a portion of the genetic code. The diagram is read from the center of the circle outwards. So, the codon AGU is translated as serine, which is an amino acid.Which conclusion about the genetic code is most strongly supported by the evidence presented in the diagram?

A sequence of mRNA contains the following bases, which are translated as three codons.ACUACGACAWhich amino acids are produced by this sequence? Select all of the amino acids that apply.

If 15% of an organism’s DNA is thymine, what is the percentage of guanine?

A scientist uses radioactive isotopes to label a double-stranded molecule of DNA. Then the DNA undergoes replication in a non-radioactive medium. Where are the two original radioactive strands of DNA?

The sequence of nitrogenous bases on a portion of a strand of DNA is shown in the diagram. From left to right, what is the corresponding sequence of the complementary strand?

The model of the double-helix model of the DNA molecule resembles a twisted ladder.What makes up the rungs of the twisted ladder?

This figure shows a section of a double-stranded DNA molecule.What aspects of the structure of DNA are explained by this model? Select threeanswer choices.

The diagram shows a model of DNA replication.Which of the following labels should NOT be added to the model?

Griffith investigated how certain types of bacteria produce pneumonia in mice. The diagram outlines his experiments. What did Griffith conclude from these experiments?

The table shows data that Chargaff collected on nitrogenous bases in the DNA in five organisms.Which statement did Chargaff conclude based on these data? (Note: A letter in brackets, such as [A] or [C], refers to the concentration of one of the nitrogenous bases.)

What is the process of creating an RNA molecule from a DNA sequence?

Which molecule serves as the template for protein synthesis?

What is a DNA nucleotide made up of?

Which molecule helps transfer amino acids to the ribosome during protein synthesis?

What is the primary function of DNA helicase?

What is the enzyme responsible for adding new nucleotides and proofreading during DNA replication?

Which molecule is single-stranded and contains uracil?

What are the three main functions of DNA?

What is the DNA base-pair rule?

A point mutation changes a codon in an mRNA molecule. Will the mutation affect the protein that forms? Why?

There are three main types of RNA: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA).Which type or types of RNA contain a copy of the instructions that a genecarries?

Study the Punnett square shown here. It describes the potential offspring of a cross between two parents.

What phenotypes will be shown by the offspring?

One dog is heterozygous for black fur (Bb), and its mate is homozygous for blonde fur (bb). The Punnett square describes a cross between the two dogs.

What is the expected outcome of the cross?

Alvin is studying a model of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of four nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U).

Alvin’s observation most strongly supports which of these conclusions?

The diagram shows a portion of the genetic code. The diagram is read from the center of the circle outwards. So, the codon AGU is translated as serine, which is an amino acid.

Which conclusion about the genetic code is most strongly supported by the evidence presented in the diagram?

A sequence of mRNA contains the following bases, which are translated as three codons.
ACUACGACA
Which amino acids are produced by this sequence? Select all of the amino acids that apply.

The model of the double-helix model of the DNA molecule resembles a twisted ladder.

What makes up the rungs of the twisted ladder?

This figure shows a section of a double-stranded DNA molecule.

What aspects of the structure of DNA are explained by this model? Select three
answer choices.

The diagram shows a model of DNA replication.

Which of the following labels should NOT be added to the model?

The table shows data that Chargaff collected on nitrogenous bases in the DNA in five organisms.

Which statement did Chargaff conclude based on these data? (Note: A letter in brackets, such as [A] or [C], refers to the concentration of one of the nitrogenous bases.)

There are three main types of RNA: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA).
Which type or types of RNA contain a copy of the instructions that a gene
carries?