Transcription Practice
star
star
star
star
star
Last updated about 1 year ago
16 questions
1
Sort the following into each step:
Sort the following into each step:
- Can either occur in the cytoplasm or the rough ER
- Starts at the promoter in DNA
- Involves a ribosome making a protein
- Involves making mRNA
- Is the first step of protein synthesis and occurs in the nucleus
- Involves making peptide bonds
- Ends at the termination sequence in DNA
- Occurs in between transcription and translation
- Involves copying a gene
- Involves RNA Polymerase
- The small step that occurs right before the mRNA leaves the nucleus to prepare the mRNA for translation
- Involves amino acids being bound together
- Involves tRNA
- Involves reading mRNA
- Transcription
- RNA Processing
- Translation
1
Does DNA contain the instructions for how to make one or many proteins?
Does DNA contain the instructions for how to make one or many proteins?
1
What is a portion of DNA that codes for/contains the instructions for how to make one protein called?
What is a portion of DNA that codes for/contains the instructions for how to make one protein called?
1
What does RNA Polymerase make?
What does RNA Polymerase make?
1
Which of the following is true about mRNA? Select all that apply.
Which of the following is true about mRNA? Select all that apply.
1
During transcription the RNA polymerase binds to the ___________ before a gene.
During transcription the RNA polymerase binds to the ___________ before a gene.
1
The whole DNA molecule is unzipped by the RNA polymerase during transcription.
The whole DNA molecule is unzipped by the RNA polymerase during transcription.
1
The RNA polymerase breaks hydrogen bonds.
The RNA polymerase breaks hydrogen bonds.
1
RNA polymerase unzips a small portion of DNA while it copies the gene, and the DNA reanneals as the RNA polymerase moves down.
RNA polymerase unzips a small portion of DNA while it copies the gene, and the DNA reanneals as the RNA polymerase moves down.
1
If the DNA has the code TACGGCTAAGTCCATAGGTAGGA what would the mRNA copy be?
If the DNA has the code TACGGCTAAGTCCATAGGTAGGA what would the mRNA copy be?
1
The RNA polymerase releases from the DNA when it reaches the ________________ at the end of the gene.
The RNA polymerase releases from the DNA when it reaches the ________________ at the end of the gene.
1
Look at the diagram above and use the following matching to label it.
Look at the diagram above and use the following matching to label it.
| Draggable item | arrow_right_alt | Corresponding Item |
|---|---|---|
Termination sequence | arrow_right_alt | G |
RNA Polymerase | arrow_right_alt | H (this is pointing to the whole green molecule) |
Nucleus | arrow_right_alt | F |
DNA | arrow_right_alt | D |
Nuclear pore | arrow_right_alt | E |
Gene | arrow_right_alt | C |
mRNA | arrow_right_alt | B |
Promoter | arrow_right_alt | A |
1
RNA processing takes place in the ______ of the cell.
RNA processing takes place in the ______ of the cell.
1
Before the mRNA leaves the nucleus during RNA processing the portions that do not code for proteins are removed. These parts of the mRNA are called ...
Before the mRNA leaves the nucleus during RNA processing the portions that do not code for proteins are removed. These parts of the mRNA are called ...
1
Then the portions of the mRNA that do code for proteins are bound together. These parts of the mRNA are called ...
Then the portions of the mRNA that do code for proteins are bound together. These parts of the mRNA are called ...
1
Then two structures are added to the ends of the mRNA to indicate which direction to read it and protect it. Which of the following is added to the mRNA before leaving the nucleus?
Then two structures are added to the ends of the mRNA to indicate which direction to read it and protect it. Which of the following is added to the mRNA before leaving the nucleus?