Sort the following into each step:
Involves reading mRNA
Involves copying a gene
Starts at the promoter in DNA
Involves a ribosome making a protein
Involves amino acids being bound together
Occurs in between transcription and translation
Involves making mRNA
The small step that occurs right before the mRNA leaves the nucleus to prepare the mRNA for translation
Involves RNA Polymerase
Can either occur in the cytoplasm or the rough ER
Involves making peptide bonds
Involves tRNA
Ends at the termination sequence in DNA
Is the first step of protein synthesis and occurs in the nucleus
Transcription
RNA Processing
Translation
Does DNA contain the instructions for how to make one or many proteins?
What is a portion of DNA that codes for/contains the instructions for how to make one protein called?
What does RNA Polymerase make?
Which of the following is true about mRNA? Select all that apply.
During transcription the RNA polymerase binds to the ___________ before a gene.
The whole DNA molecule is unzipped by the RNA polymerase during transcription.
The RNA polymerase breaks hydrogen bonds.
RNA polymerase unzips a small portion of DNA while it copies the gene, and the DNA reanneals as the RNA polymerase moves down.
If the DNA has the code TACGGCTAAGTCCATAGGTAGGA what would the mRNA copy be?
The RNA polymerase releases from the DNA when it reaches the ________________ at the end of the gene.
Look at the diagram above and use the following matching to label it.
| Stavka koja se može prevući | arrow_right_alt | Odgovarajuća stavka |
|---|---|---|
Nucleus | arrow_right_alt | G |
Nuclear pore | arrow_right_alt | H (this is pointing to the whole green molecule) |
mRNA | arrow_right_alt | F |
Gene | arrow_right_alt | D |
Promoter | arrow_right_alt | E |
RNA Polymerase | arrow_right_alt | C |
DNA | arrow_right_alt | B |
Termination sequence | arrow_right_alt | A |
RNA processing takes place in the ______ of the cell.
Before the mRNA leaves the nucleus during RNA processing the portions that do not code for proteins are removed. These parts of the mRNA are called ...
Then the portions of the mRNA that do code for proteins are bound together. These parts of the mRNA are called ...
Then two structures are added to the ends of the mRNA to indicate which direction to read it and protect it. Which of the following is added to the mRNA before leaving the nucleus?