Transcription Practice

Last updated over 1 year ago

16 questions

1

Library

Transcription Practice

Last updated over 1 year ago

16 questions

1

Does DNA contain the instructions for how to make one or many proteins?

1

What is a portion of DNA that codes for/contains the instructions for how to make one protein called?

1

What does RNA Polymerase make?

1

During transcription the RNA polymerase binds to the ___________ before a gene.

1

The whole DNA molecule is unzipped by the RNA polymerase during transcription.

1

The RNA polymerase breaks hydrogen bonds.

1

RNA polymerase unzips a small portion of DNA while it copies the gene, and the DNA reanneals as the RNA polymerase moves down.

1

If the DNA has the code TACGGCTAAGTCCATAGGTAGGA what would the mRNA copy be?

1

The RNA polymerase releases from the DNA when it reaches the ________________ at the end of the gene.

1

Draggable item		Corresponding Item

1

RNA processing takes place in the ______ of the cell.

1

Before the mRNA leaves the nucleus during RNA processing the portions that do not code for proteins are removed. These parts of the mRNA are called ...

1

Then the portions of the mRNA that do code for proteins are bound together. These parts of the mRNA are called ...

1

Then two structures are added to the ends of the mRNA to indicate which direction to read it and protect it. Which of the following is added to the mRNA before leaving the nucleus?

Sort the following into each step:

Ends at the termination sequence in DNA
Occurs in between transcription and translation
Involves a ribosome making a protein
Is the first step of protein synthesis and occurs in the nucleus
The small step that occurs right before the mRNA leaves the nucleus to prepare the mRNA for translation
Involves making peptide bonds
Involves copying a gene
Involves amino acids being bound together
Starts at the promoter in DNA
Involves RNA Polymerase
Can either occur in the cytoplasm or the rough ER
Involves tRNA
Involves making mRNA
Involves reading mRNA

Transcription
RNA Processing
Translation

Does DNA contain the instructions for how to make one or many proteins?

What is a portion of DNA that codes for/contains the instructions for how to make one protein called?

What does RNA Polymerase make?

Which of the following is true about mRNA? Select all that apply.

During transcription the RNA polymerase binds to the ___________ before a gene.

The whole DNA molecule is unzipped by the RNA polymerase during transcription.

The RNA polymerase breaks hydrogen bonds.

RNA polymerase unzips a small portion of DNA while it copies the gene, and the DNA reanneals as the RNA polymerase moves down.

If the DNA has the code TACGGCTAAGTCCATAGGTAGGA what would the mRNA copy be?

The RNA polymerase releases from the DNA when it reaches the ________________ at the end of the gene.

Look at the diagram above and use the following matching to label it.

Draggable item		Corresponding Item
Gene		G
Nucleus		H (this is pointing to the whole green molecule)
DNA		F
RNA Polymerase		D
mRNA		E
Promoter		C
Termination sequence		B
Nuclear pore		A

RNA processing takes place in the ______ of the cell.

Before the mRNA leaves the nucleus during RNA processing the portions that do not code for proteins are removed. These parts of the mRNA are called ...

Then the portions of the mRNA that do code for proteins are bound together. These parts of the mRNA are called ...

Then two structures are added to the ends of the mRNA to indicate which direction to read it and protect it. Which of the following is added to the mRNA before leaving the nucleus?

Sort the following into each step:

Ends at the termination sequence in DNA

Occurs in between transcription and translation

Involves a ribosome making a protein

Is the first step of protein synthesis and occurs in the nucleus

The small step that occurs right before the mRNA leaves the nucleus to prepare the mRNA for translation

Involves making peptide bonds

Involves copying a gene

Involves amino acids being bound together

Starts at the promoter in DNA

Involves RNA Polymerase

Can either occur in the cytoplasm or the rough ER

Involves tRNA

Involves making mRNA

Involves reading mRNA

Transcription

RNA Processing

Translation

Which of the following is true about mRNA? Select all that apply.

It is a nucleic acid

It can enter the cytoplasm

It tells your cells which order to bind amino acids in when making a protein

It is made by DNA polymerase

It is made of amino acids

It is made of nucleotides

It contains the nitrogenous bases A, T, G, and C

It is a type of RNA

It is read by a ribosome

It carries the instructions for how to make one protein out of the nucleus

It is a copy of a gene

It can enter the rough ER

It is a polymer

It binds together amino acids

It leaves the nucleus through a nuclear pore

It contains the nitrogenous bases A, U, G, and C

It makes peptide bonds

Look at the diagram above and use the following matching to label it.

Gene

G

Nucleus

H (this is pointing to the whole green molecule)

DNA

F

RNA Polymerase

D

mRNA

E

Promoter

C

Termination sequence

B

Nuclear pore

A

Cap

Cap A tail

Poly A tail

Mono A tail