Sign up for FREE

Copy of Protein Synthesis and Mutations (5/28/2026)

Last updated about 2 hours ago

6 questions

1

1

2

1

2

1

Question 1

1.

Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:
TACACGCAATTACCAGGGTAGCCATTGATT
Use the space bar to separate your sequence into codons.

Question 2

2.

Use the genetic code chart provided above to translate your sequence of RNA base codons into an amino acid sequence to make a protein. Copy the three letters representing each amino acid as shown on the chart. Separate each of your amino acids from the others with a space.

Question 3

3.

Explain what would happen if there was a substitution mutation that changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. Don't forget to separate each codon with a space.

Question 4

4.

Write the sequence of amino acids that would result from this kind of mutation.

Question 5

5.

Let's say that there is a deletion mutation that caused that same base in the DNA (the C in the 5th place from the beginning) to be missing from the DNA sequence?
Write the sequence of RNA codons that would result from this kind of mutation.

Question 6

6.

Write the sequence of amino acids based on the RNA codons you wrote in #5 that would result from this deletion mutation. (Compare your sequence to the sequence you wrote for #2 - think about how that one missing base affected the protein)